From: Charles Plessy Date: Sat, 19 Apr 2014 02:54:31 +0000 (+0900) Subject: Add back files that were accidentally deleted when merging upstream release. X-Git-Tag: archive/raspbian/0.22.0+ds-1+rpi1~1^2^2~385 X-Git-Url: https://dgit.raspbian.org/%22http:/www.example.com/cgi/%22https:/%22bookmarks:/%22file:///%22http:/www.example.com/cgi/%22https:/%22bookmarks:/%22file:/?a=commitdiff_plain;h=b796897f2c14930b3bb09de8607366e881f20540;p=python-pysam.git Add back files that were accidentally deleted when merging upstream release. --- diff --git a/debian/compat b/debian/compat new file mode 100644 index 0000000..ec63514 --- /dev/null +++ b/debian/compat @@ -0,0 +1 @@ +9 diff --git a/debian/patches/do_not_use_distribute_setup.patch b/debian/patches/do_not_use_distribute_setup.patch new file mode 100644 index 0000000..fd60f92 --- /dev/null +++ b/debian/patches/do_not_use_distribute_setup.patch @@ -0,0 +1,17 @@ +Author: Olivier Sallou +Last-Updated: Fri, 07 Feb 2014 18:29:40 +0100 +Description: Prevent downloading distribute_setup + +--- pysam.orig/setup.py ++++ pysam/setup.py +@@ -127,8 +127,8 @@ + # cp samtools/win32/*.h pysam/include/win32 + + +-from distribute_setup import use_setuptools +-use_setuptools() ++#from distribute_setup import use_setuptools ++#use_setuptools() + + from setuptools import Extension, setup, find_packages + diff --git a/debian/patches/fix_cleanup_tests.patch b/debian/patches/fix_cleanup_tests.patch new file mode 100644 index 0000000..178876e --- /dev/null +++ b/debian/patches/fix_cleanup_tests.patch @@ -0,0 +1,19 @@ +Author: Andreas Tille +Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100 +Description: Prevent tests makefile from deleting files which + are contained inside the upstream source + +--- a/tests/Makefile ++++ b/tests/Makefile +@@ -47,6 +47,11 @@ example_bai.bam: ex1.bam + + + clean: ++ mkdir keep_bam_files ++ mv ex9_fail.bam ex9_nofail.bam example_btag.bam example_empty_header.bam issue100.bam tag_bug.bam test_unaligned.bam keep_bam_files + rm -fr *.bam *.bai *.fai *.pileup* \ + *~ calDepth *.dSYM pysam_*.sam \ + ex2.sam ex2.sam.gz ex1.sam ++ mv keep_bam_files/* . ++ rmdir keep_bam_files ++ rm -rf pysam_test_work/ diff --git a/debian/patches/offline-tests.patch b/debian/patches/offline-tests.patch new file mode 100644 index 0000000..968b5ba --- /dev/null +++ b/debian/patches/offline-tests.patch @@ -0,0 +1,1824 @@ +Author: Andreas Tille +Last-Changed: Mon, 10 Feb 2014 11:29:40 +0100 +Description: Create a copy of the test suite script and remove those + tests that try to fetch files from network + +--- /dev/null ++++ b/tests/pysam_test_offline.py +@@ -0,0 +1,1816 @@ ++#!/usr/bin/env python ++'''unit testing code for pysam. ++ ++Execute in the :file:`tests` directory as it requires the Makefile ++and data files located there. ++''' ++ ++import pysam ++import unittest ++import os, re, sys ++import itertools ++import collections ++import subprocess ++import shutil ++import logging ++ ++IS_PYTHON3 = sys.version_info[0] >= 3 ++ ++if IS_PYTHON3: ++ from itertools import zip_longest ++else: ++ from itertools import izip as zip_longest ++ ++ ++SAMTOOLS="samtools" ++WORKDIR="pysam_test_work" ++ ++def checkBinaryEqual( filename1, filename2 ): ++ '''return true if the two files are binary equal.''' ++ if os.path.getsize( filename1 ) != os.path.getsize( filename2 ): ++ return False ++ ++ infile1 = open(filename1, "rb") ++ infile2 = open(filename2, "rb") ++ ++ def chariter( infile ): ++ while 1: ++ c = infile.read(1) ++ if c == b"": break ++ yield c ++ ++ found = False ++ for c1,c2 in zip_longest( chariter( infile1), chariter( infile2) ): ++ if c1 != c2: break ++ else: ++ found = True ++ ++ infile1.close() ++ infile2.close() ++ return found ++ ++def runSamtools( cmd ): ++ '''run a samtools command''' ++ ++ try: ++ retcode = subprocess.call(cmd, shell=True, ++ stderr = subprocess.PIPE) ++ if retcode < 0: ++ print("Child was terminated by signal", -retcode) ++ except OSError as e: ++ print("Execution failed:", e) ++ ++def getSamtoolsVersion(): ++ '''return samtools version''' ++ ++ with subprocess.Popen(SAMTOOLS, shell=True, stderr=subprocess.PIPE).stderr as pipe: ++ lines = b"".join(pipe.readlines()) ++ ++ if IS_PYTHON3: ++ lines = lines.decode('ascii') ++ return re.search( "Version:\s+(\S+)", lines).groups()[0] ++ ++class BinaryTest(unittest.TestCase): ++ '''test samtools command line commands and compare ++ against pysam commands. ++ ++ Tests fail, if the output is not binary identical. ++ ''' ++ ++ first_time = True ++ ++ # a dictionary of commands to test ++ # first entry: (samtools output file, samtools command) ++ # second entry: (pysam output file, (pysam function, pysam options) ) ++ commands = \ ++ { ++ "view" : ++ ( ++ ("ex1.view", "view ex1.bam > ex1.view"), ++ ("pysam_ex1.view", (pysam.view, "ex1.bam" ) ), ++ ), ++ "view2" : ++ ( ++ ("ex1.view", "view -bT ex1.fa -o ex1.view2 ex1.sam"), ++ # note that -o ex1.view2 throws exception. ++ ("pysam_ex1.view", (pysam.view, "-bT ex1.fa -oex1.view2 ex1.sam" ) ), ++ ), ++ "sort" : ++ ( ++ ( "ex1.sort.bam", "sort ex1.bam ex1.sort" ), ++ ( "pysam_ex1.sort.bam", (pysam.sort, "ex1.bam pysam_ex1.sort" ) ), ++ ), ++ "mpileup" : ++ ( ++ ("ex1.pileup", "mpileup ex1.bam > ex1.pileup" ), ++ ("pysam_ex1.mpileup", (pysam.mpileup, "ex1.bam" ) ), ++ ), ++ "depth" : ++ ( ++ ("ex1.depth", "depth ex1.bam > ex1.depth" ), ++ ("pysam_ex1.depth", (pysam.depth, "ex1.bam" ) ), ++ ), ++ "faidx" : ++ ( ++ ("ex1.fa.fai", "faidx ex1.fa"), ++ ("pysam_ex1.fa.fai", (pysam.faidx, "ex1.fa") ), ++ ), ++ "index": ++ ( ++ ("ex1.bam.bai", "index ex1.bam" ), ++ ("pysam_ex1.bam.bai", (pysam.index, "pysam_ex1.bam" ) ), ++ ), ++ "idxstats" : ++ ( ++ ("ex1.idxstats", "idxstats ex1.bam > ex1.idxstats" ), ++ ("pysam_ex1.idxstats", (pysam.idxstats, "pysam_ex1.bam" ) ), ++ ), ++ "fixmate" : ++ ( ++ ("ex1.fixmate", "fixmate ex1.bam ex1.fixmate" ), ++ ("pysam_ex1.fixmate", (pysam.fixmate, "pysam_ex1.bam pysam_ex1.fixmate") ), ++ ), ++ "flagstat" : ++ ( ++ ("ex1.flagstat", "flagstat ex1.bam > ex1.flagstat" ), ++ ("pysam_ex1.flagstat", (pysam.flagstat, "pysam_ex1.bam") ), ++ ), ++ "calmd" : ++ ( ++ ("ex1.calmd", "calmd ex1.bam ex1.fa > ex1.calmd" ), ++ ("pysam_ex1.calmd", (pysam.calmd, "pysam_ex1.bam ex1.fa") ), ++ ), ++ "merge" : ++ ( ++ ("ex1.merge", "merge -f ex1.merge ex1.bam ex1.bam" ), ++ # -f option does not work - following command will cause the subsequent ++ # command to fail ++ ("pysam_ex1.merge", (pysam.merge, "pysam_ex1.merge pysam_ex1.bam pysam_ex1.bam") ), ++ ), ++ "rmdup" : ++ ( ++ ("ex1.rmdup", "rmdup ex1.bam ex1.rmdup" ), ++ ("pysam_ex1.rmdup", (pysam.rmdup, "pysam_ex1.bam pysam_ex1.rmdup" )), ++ ), ++ "reheader" : ++ ( ++ ( "ex1.reheader", "reheader ex1.bam ex1.bam > ex1.reheader"), ++ ( "pysam_ex1.reheader", (pysam.reheader, "ex1.bam ex1.bam" ) ), ++ ), ++ "cat": ++ ( ++ ( "ex1.cat", "cat ex1.bam ex1.bam > ex1.cat"), ++ ( "pysam_ex1.cat", (pysam.cat, "ex1.bam ex1.bam" ) ), ++ ), ++ "targetcut": ++ ( ++ ("ex1.targetcut", "targetcut ex1.bam > ex1.targetcut" ), ++ ("pysam_ex1.targetcut", (pysam.targetcut, "pysam_ex1.bam") ), ++ ), ++ "phase": ++ ( ++ ("ex1.phase", "phase ex1.bam > ex1.phase" ), ++ ("pysam_ex1.phase", (pysam.phase, "pysam_ex1.bam") ), ++ ), ++ "import" : ++ ( ++ ("ex1.bam", "import ex1.fa.fai ex1.sam.gz ex1.bam" ), ++ ("pysam_ex1.bam", (pysam.samimport, "ex1.fa.fai ex1.sam.gz pysam_ex1.bam") ), ++ ), ++ "bam2fq": ++ ( ++ ("ex1.bam2fq", "bam2fq ex1.bam > ex1.bam2fq" ), ++ ("pysam_ex1.bam2fq", (pysam.bam2fq, "pysam_ex1.bam") ), ++ ), ++ "pad2unpad": ++ ( ++ ("ex2.unpad", "pad2unpad -T ex1.fa ex2.bam > ex2.unpad" ), ++ ("pysam_ex2.unpad", (pysam.pad2unpad, "-T ex1.fa ex2.bam") ), ++ ), ++ "bamshuf": ++ ( ++ ("ex1.bamshuf.bam", "bamshuf ex1.bam ex1.bamshuf" ), ++ ("pysam_ex1.bamshuf.bam", (pysam.bamshuf, "ex1.bam pysam_ex1.bamshuf") ), ++ ), ++ "bedcov": ++ ( ++ ("ex1.bedcov", "bedcov ex1.bed ex1.bam > ex1.bedcov" ), ++ ("pysam_ex1.bedcov", (pysam.bedcov, "ex1.bed ex1.bam") ), ++ ), ++ } ++ ++ # some tests depend on others. The order specifies in which order ++ # the samtools commands are executed. ++ # The first three (faidx, import, index) need to be in that order, ++ # the rest is arbitrary. ++ order = ('faidx', 'import', 'index', ++ # 'pileup1', 'pileup2', deprecated ++ # 'glfview', deprecated ++ 'view', 'view2', ++ 'sort', ++ 'mpileup', ++ 'depth', ++ 'idxstats', ++ 'fixmate', ++ 'flagstat', ++ ## 'calmd', ++ 'merge', ++ 'rmdup', ++ 'reheader', ++ 'cat', ++ 'bedcov', ++ 'targetcut', ++ 'phase', ++ 'bamshuf', ++ 'bam2fq', ++ 'pad2unpad', ++ ) ++ ++ def setUp( self ): ++ '''setup tests. ++ ++ For setup, all commands will be run before the first test is ++ executed. Individual tests will then just compare the output ++ files. ++ ''' ++ if BinaryTest.first_time: ++ ++ # remove previous files ++ if os.path.exists( WORKDIR ): ++ shutil.rmtree( WORKDIR ) ++ pass ++ ++ # copy the source files to WORKDIR ++ os.makedirs( WORKDIR ) ++ ++ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "pysam_ex1.fa" ) ) ++ shutil.copy( "ex1.fa", os.path.join( WORKDIR, "ex1.fa" ) ) ++ shutil.copy( "ex1.sam.gz", os.path.join( WORKDIR, "ex1.sam.gz" ) ) ++ shutil.copy( "ex1.sam", os.path.join( WORKDIR, "ex1.sam" ) ) ++ shutil.copy( "ex2.bam", os.path.join( WORKDIR, "ex2.bam" ) ) ++ ++ # cd to workdir ++ savedir = os.getcwd() ++ os.chdir( WORKDIR ) ++ ++ for label in self.order: ++ # print ("command=", label) ++ command = self.commands[label] ++ # build samtools command and target and run ++ samtools_target, samtools_command = command[0] ++ runSamtools( " ".join( (SAMTOOLS, samtools_command ))) ++ ++ # get pysam command and run ++ try: ++ pysam_target, pysam_command = command[1] ++ except ValueError as msg: ++ raise ValueError( "error while setting up %s=%s: %s" %\ ++ (label, command, msg) ) ++ ++ pysam_method, pysam_options = pysam_command ++ try: ++ output = pysam_method( *pysam_options.split(" "), raw=True) ++ except pysam.SamtoolsError as msg: ++ raise pysam.SamtoolsError( "error while executing %s: options=%s: msg=%s" %\ ++ (label, pysam_options, msg) ) ++ ++ ++ if ">" in samtools_command: ++ with open( pysam_target, "wb" ) as outfile: ++ if type(output) == list: ++ if IS_PYTHON3: ++ for line in output: ++ outfile.write( line.encode('ascii') ) ++ else: ++ for line in output: outfile.write( line ) ++ else: ++ outfile.write(output) ++ ++ os.chdir( savedir ) ++ BinaryTest.first_time = False ++ ++ samtools_version = getSamtoolsVersion() ++ ++ ++ def _r( s ): ++ # patch - remove any of the alpha/beta suffixes, i.e., 0.1.12a -> 0.1.12 ++ if s.count('-') > 0: s = s[0:s.find('-')] ++ return re.sub( "[^0-9.]", "", s ) ++ ++ if _r(samtools_version) != _r( pysam.__samtools_version__): ++ raise ValueError("versions of pysam/samtools and samtools differ: %s != %s" % \ ++ (pysam.__samtools_version__, ++ samtools_version )) ++ ++ def checkCommand( self, command ): ++ if command: ++ samtools_target, pysam_target = self.commands[command][0][0], self.commands[command][1][0] ++ samtools_target = os.path.join( WORKDIR, samtools_target ) ++ pysam_target = os.path.join( WORKDIR, pysam_target ) ++ self.assertTrue( checkBinaryEqual( samtools_target, pysam_target ), ++ "%s failed: files %s and %s are not the same" % (command, samtools_target, pysam_target) ) ++ ++ def testImport( self ): ++ self.checkCommand( "import" ) ++ ++ def testIndex( self ): ++ self.checkCommand( "index" ) ++ ++ def testSort( self ): ++ self.checkCommand( "sort" ) ++ ++ def testMpileup( self ): ++ self.checkCommand( "mpileup" ) ++ ++ def testDepth( self ): ++ self.checkCommand( "depth" ) ++ ++ def testIdxstats( self ): ++ self.checkCommand( "idxstats" ) ++ ++ def testFixmate( self ): ++ self.checkCommand( "fixmate" ) ++ ++ def testFlagstat( self ): ++ self.checkCommand( "flagstat" ) ++ ++ def testMerge( self ): ++ self.checkCommand( "merge" ) ++ ++ def testRmdup( self ): ++ self.checkCommand( "rmdup" ) ++ ++ def testReheader( self ): ++ self.checkCommand( "reheader" ) ++ ++ def testCat( self ): ++ self.checkCommand( "cat" ) ++ ++ def testTargetcut( self ): ++ self.checkCommand( "targetcut" ) ++ ++ def testPhase( self ): ++ self.checkCommand( "phase" ) ++ ++ def testBam2fq( self ): ++ self.checkCommand( "bam2fq" ) ++ ++ def testBedcov( self ): ++ self.checkCommand( "bedcov" ) ++ ++ def testBamshuf( self ): ++ self.checkCommand( "bamshuf" ) ++ ++ def testPad2Unpad( self ): ++ self.checkCommand( "pad2unpad" ) ++ ++ # def testPileup1( self ): ++ # self.checkCommand( "pileup1" ) ++ ++ # def testPileup2( self ): ++ # self.checkCommand( "pileup2" ) ++ ++ # deprecated ++ # def testGLFView( self ): ++ # self.checkCommand( "glfview" ) ++ ++ def testView( self ): ++ self.checkCommand( "view" ) ++ ++ def testEmptyIndex( self ): ++ self.assertRaises( IOError, pysam.index, "exdoesntexist.bam" ) ++ ++ def __del__(self): ++ if os.path.exists( WORKDIR ): ++ pass ++ # shutil.rmtree( WORKDIR ) ++ ++class IOTest(unittest.TestCase): ++ '''check if reading samfile and writing a samfile are consistent.''' ++ ++ def checkEcho( self, input_filename, ++ reference_filename, ++ output_filename, ++ input_mode, output_mode, use_template = True ): ++ '''iterate through *input_filename* writing to *output_filename* and ++ comparing the output to *reference_filename*. ++ ++ The files are opened according to the *input_mode* and *output_mode*. ++ ++ If *use_template* is set, the header is copied from infile using the ++ template mechanism, otherwise target names and lengths are passed ++ explicitely. ++ ++ ''' ++ ++ infile = pysam.Samfile( input_filename, input_mode ) ++ if use_template: ++ outfile = pysam.Samfile( output_filename, output_mode, template = infile ) ++ else: ++ outfile = pysam.Samfile( output_filename, output_mode, ++ referencenames = infile.references, ++ referencelengths = infile.lengths, ++ add_sq_text = False ) ++ ++ iter = infile.fetch() ++ ++ for x in iter: outfile.write( x ) ++ infile.close() ++ outfile.close() ++ ++ self.assertTrue( checkBinaryEqual( reference_filename, output_filename), ++ "files %s and %s are not the same" % (reference_filename, output_filename) ) ++ ++ ++ def testReadWriteBam( self ): ++ ++ input_filename = "ex1.bam" ++ output_filename = "pysam_ex1.bam" ++ reference_filename = "ex1.bam" ++ ++ self.checkEcho( input_filename, reference_filename, output_filename, ++ "rb", "wb" ) ++ ++ def testReadWriteBamWithTargetNames( self ): ++ ++ input_filename = "ex1.bam" ++ output_filename = "pysam_ex1.bam" ++ reference_filename = "ex1.bam" ++ ++ self.checkEcho( input_filename, reference_filename, output_filename, ++ "rb", "wb", use_template = False ) ++ ++ def testReadWriteSamWithHeader( self ): ++ ++ input_filename = "ex2.sam" ++ output_filename = "pysam_ex2.sam" ++ reference_filename = "ex2.sam" ++ ++ self.checkEcho( input_filename, reference_filename, output_filename, ++ "r", "wh" ) ++ ++ def testReadWriteSamWithoutHeader( self ): ++ ++ input_filename = "ex2.sam" ++ output_filename = "pysam_ex2.sam" ++ reference_filename = "ex1.sam" ++ ++ self.checkEcho( input_filename, reference_filename, output_filename, ++ "r", "w" ) ++ ++ def testReadSamWithoutTargetNames( self ): ++ '''see issue 104.''' ++ input_filename = "example_unmapped_reads_no_sq.sam" ++ ++ # raise exception in default mode ++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" ) ++ ++ # raise exception if no SQ files ++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r", ++ check_header = True) ++ ++ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False ) ++ result = list(infile.fetch()) ++ ++ def testReadBamWithoutTargetNames( self ): ++ '''see issue 104.''' ++ input_filename = "example_unmapped_reads_no_sq.bam" ++ ++ # raise exception in default mode ++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" ) ++ ++ # raise exception if no SQ files ++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r", ++ check_header = True) ++ ++ ++ infile = pysam.Samfile( input_filename, check_header = False, check_sq = False ) ++ result = list(infile.fetch( until_eof = True)) ++ ++ def testReadSamWithoutHeader( self ): ++ input_filename = "ex1.sam" ++ output_filename = "pysam_ex1.sam" ++ reference_filename = "ex1.sam" ++ ++ # reading from a samfile without header is not implemented. ++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" ) ++ ++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r", ++ check_header = False ) ++ ++ def testReadUnformattedFile( self ): ++ '''test reading from a file that is not bam/sam formatted''' ++ input_filename = "example.vcf40" ++ ++ # bam - file raise error ++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "rb" ) ++ ++ # sam - file error, but can't fetch ++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r" ) ++ ++ self.assertRaises( ValueError, pysam.Samfile, input_filename, "r", ++ check_header = False) ++ ++ def testBAMWithoutAlignedReads( self ): ++ '''see issue 117''' ++ input_filename = "test_unaligned.bam" ++ samfile = pysam.Samfile( input_filename, "rb", check_sq = False ) ++ samfile.fetch( until_eof = True ) ++ ++ def testBAMWithShortBAI( self ): ++ '''see issue 116''' ++ input_filename = "example_bai.bam" ++ samfile = pysam.Samfile( input_filename, "rb", check_sq = False ) ++ samfile.fetch( 'chr2' ) ++ ++ def testFetchFromClosedFile( self ): ++ ++ samfile = pysam.Samfile( "ex1.bam", "rb" ) ++ samfile.close() ++ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120) ++ ++ def testClosedFile( self ): ++ '''test that access to a closed samfile raises ValueError.''' ++ ++ samfile = pysam.Samfile( "ex1.bam", "rb" ) ++ samfile.close() ++ self.assertRaises( ValueError, samfile.fetch, 'chr1', 100, 120) ++ self.assertRaises( ValueError, samfile.pileup, 'chr1', 100, 120) ++ self.assertRaises( ValueError, samfile.getrname, 0 ) ++ self.assertRaises( ValueError, samfile.tell ) ++ self.assertRaises( ValueError, samfile.seek, 0 ) ++ self.assertRaises( ValueError, getattr, samfile, "nreferences" ) ++ self.assertRaises( ValueError, getattr, samfile, "references" ) ++ self.assertRaises( ValueError, getattr, samfile, "lengths" ) ++ self.assertRaises( ValueError, getattr, samfile, "text" ) ++ self.assertRaises( ValueError, getattr, samfile, "header" ) ++ ++ # write on closed file ++ self.assertEqual( 0, samfile.write(None) ) ++ ++ def testAutoDetection( self ): ++ '''test if autodetection works.''' ++ ++ samfile = pysam.Samfile( "ex3.sam" ) ++ self.assertRaises( ValueError, samfile.fetch, 'chr1' ) ++ samfile.close() ++ ++ samfile = pysam.Samfile( "ex3.bam" ) ++ samfile.fetch('chr1') ++ samfile.close() ++ ++ def testReadingFromSamFileWithoutHeader( self ): ++ '''read from samfile without header. ++ ''' ++ samfile = pysam.Samfile( "ex7.sam", check_header = False, check_sq = False ) ++ self.assertRaises( NotImplementedError, samfile.__iter__ ) ++ ++ def testReadingFromFileWithoutIndex( self ): ++ '''read from bam file without index.''' ++ ++ assert not os.path.exists( "ex2.bam.bai" ) ++ samfile = pysam.Samfile( "ex2.bam", "rb" ) ++ self.assertRaises( ValueError, samfile.fetch ) ++ self.assertEqual( len(list( samfile.fetch(until_eof = True) )), 3270 ) ++ ++ def testReadingUniversalFileMode( self ): ++ '''read from samfile without header. ++ ''' ++ ++ input_filename = "ex2.sam" ++ output_filename = "pysam_ex2.sam" ++ reference_filename = "ex1.sam" ++ ++ self.checkEcho( input_filename, reference_filename, output_filename, ++ "rU", "w" ) ++ ++class TestFloatTagBug( unittest.TestCase ): ++ '''see issue 71''' ++ ++ def testFloatTagBug( self ): ++ '''a float tag before another exposed a parsing bug in bam_aux_get. ++ ++ Fixed in 0.1.19 ++ ''' ++ samfile = pysam.Samfile("tag_bug.bam") ++ read = next(samfile.fetch(until_eof=True)) ++ self.assertTrue( ('XC',1) in read.tags ) ++ self.assertEqual(read.opt('XC'), 1) ++ ++class TestLargeFieldBug( unittest.TestCase ): ++ '''see issue 100''' ++ ++ def testLargeFileBug( self ): ++ '''when creating a read with a large entry in the tag field ++ causes an errror: ++ NotImplementedError: tags field too large ++ ''' ++ samfile = pysam.Samfile("issue100.bam") ++ read = next(samfile.fetch(until_eof=True)) ++ new_read = pysam.AlignedRead() ++ new_read.tags = read.tags ++ self.assertEqual( new_read.tags, read.tags ) ++ ++class TestTagParsing( unittest.TestCase ): ++ '''tests checking the accuracy of tag setting and retrieval.''' ++ ++ def makeRead( self ): ++ a = pysam.AlignedRead() ++ a.qname = "read_12345" ++ a.tid = 0 ++ a.seq="ACGT" * 3 ++ a.flag = 0 ++ a.rname = 0 ++ a.pos = 1 ++ a.mapq = 20 ++ a.cigar = ( (0,10), (2,1), (0,25) ) ++ a.mrnm = 0 ++ a.mpos=200 ++ a.isize = 0 ++ a.qual ="1234" * 3 ++ # todo: create tags ++ return a ++ ++ def testNegativeIntegers( self ): ++ x = -2 ++ aligned_read = self.makeRead() ++ aligned_read.tags = [("XD", int(x) ) ] ++ # print (aligned_read.tags) ++ ++ def testNegativeIntegers2( self ): ++ x = -2 ++ r = self.makeRead() ++ r.tags = [("XD", int(x) ) ] ++ outfile = pysam.Samfile( "test.bam", ++ "wb", ++ referencenames = ("chr1",), ++ referencelengths = (1000,) ) ++ outfile.write (r ) ++ outfile.close() ++ ++ def testCigarString( self ): ++ r = self.makeRead() ++ self.assertEqual( r.cigarstring, "10M1D25M" ) ++ r.cigarstring = "20M10D20M" ++ self.assertEqual( r.cigar, [(0,20), (2,10), (0,20)]) ++ ++ def testLongTags( self ): ++ '''see issue 115''' ++ ++ r = self.makeRead() ++ rg = 'HS2000-899_199.L3' ++ tags = [('XC', 85), ('XT', 'M'), ('NM', 5), ('SM', 29), ('AM', 29), ('XM', 1), ('XO', 1), ('XG', 4), ('MD', '37^ACCC29T18'), ('XA','5,+11707,36M1I48M,2;21,-48119779,46M1I38M,2;hs37d5,-10060835,40M1D45M,3;5,+11508,36M1I48M,3;hs37d5,+6743812,36M1I48M,3;19,-59118894,46M1I38M,3;4,-191044002,6M1I78M,3;')] ++ ++ r.tags = tags ++ r.tags += [("RG",rg)] * 100 ++ tags += [("RG",rg)] * 100 ++ ++ self.assertEqual( tags, r.tags ) ++ ++class TestIteratorRow(unittest.TestCase): ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex1.bam","rb" ) ++ ++ def checkRange( self, rnge ): ++ '''compare results from iterator with those from samtools.''' ++ ps = list(self.samfile.fetch(region=rnge)) ++ sa = list(pysam.view( "ex1.bam", rnge, raw = True) ) ++ self.assertEqual( len(ps), len(sa), "unequal number of results for range %s: %i != %i" % (rnge, len(ps), len(sa) )) ++ # check if the same reads are returned and in the same order ++ for line, (a, b) in enumerate( list(zip( ps, sa )) ): ++ d = b.split("\t") ++ self.assertEqual( a.qname, d[0], "line %i: read id mismatch: %s != %s" % (line, a.rname, d[0]) ) ++ self.assertEqual( a.pos, int(d[3])-1, "line %i: read position mismatch: %s != %s, \n%s\n%s\n" % \ ++ (line, a.pos, int(d[3])-1, ++ str(a), str(d) ) ) ++ if sys.version_info[0] < 3: ++ qual = d[10] ++ else: ++ qual = d[10].encode('ascii') ++ self.assertEqual( a.qual, qual, "line %i: quality mismatch: %s != %s, \n%s\n%s\n" % \ ++ (line, a.qual, qual, ++ str(a), str(d) ) ) ++ ++ def testIteratePerContig(self): ++ '''check random access per contig''' ++ for contig in self.samfile.references: ++ self.checkRange( contig ) ++ ++ def testIterateRanges(self): ++ '''check random access per range''' ++ for contig, length in zip(self.samfile.references, self.samfile.lengths): ++ for start in range( 1, length, 90): ++ self.checkRange( "%s:%i-%i" % (contig, start, start + 90) ) # this includes empty ranges ++ ++ def tearDown(self): ++ self.samfile.close() ++ ++ ++class TestIteratorRowAll(unittest.TestCase): ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex1.bam","rb" ) ++ ++ def testIterate(self): ++ '''compare results from iterator with those from samtools.''' ++ ps = list(self.samfile.fetch()) ++ sa = list(pysam.view( "ex1.bam", raw = True) ) ++ self.assertEqual( len(ps), len(sa), "unequal number of results: %i != %i" % (len(ps), len(sa) )) ++ # check if the same reads are returned ++ for line, pair in enumerate( list(zip( ps, sa )) ): ++ data = pair[1].split("\t") ++ self.assertEqual( pair[0].qname, data[0], "read id mismatch in line %i: %s != %s" % (line, pair[0].rname, data[0]) ) ++ ++ def tearDown(self): ++ self.samfile.close() ++ ++class TestIteratorColumn(unittest.TestCase): ++ '''test iterator column against contents of ex4.bam.''' ++ ++ # note that samfile contains 1-based coordinates ++ # 1D means deletion with respect to reference sequence ++ # ++ mCoverages = { 'chr1' : [ 0 ] * 20 + [1] * 36 + [0] * (100 - 20 -35 ), ++ 'chr2' : [ 0 ] * 20 + [1] * 35 + [0] * (100 - 20 -35 ), ++ } ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex4.bam","rb" ) ++ ++ def checkRange( self, contig, start = None, end = None, truncate = False ): ++ '''compare results from iterator with those from samtools.''' ++ # check if the same reads are returned and in the same order ++ for column in self.samfile.pileup(contig, start, end, truncate = truncate): ++ if truncate: ++ self.assertGreaterEqual( column.pos, start ) ++ self.assertLess( column.pos, end ) ++ thiscov = len(column.pileups) ++ refcov = self.mCoverages[self.samfile.getrname(column.tid)][column.pos] ++ self.assertEqual( thiscov, refcov, "wrong coverage at pos %s:%i %i should be %i" % (self.samfile.getrname(column.tid), column.pos, thiscov, refcov)) ++ ++ def testIterateAll(self): ++ '''check random access per contig''' ++ self.checkRange( None ) ++ ++ def testIteratePerContig(self): ++ '''check random access per contig''' ++ for contig in self.samfile.references: ++ self.checkRange( contig ) ++ ++ def testIterateRanges(self): ++ '''check random access per range''' ++ for contig, length in zip(self.samfile.references, self.samfile.lengths): ++ for start in range( 1, length, 90): ++ self.checkRange( contig, start, start + 90 ) # this includes empty ranges ++ ++ def testInverse( self ): ++ '''test the inverse, is point-wise pileup accurate.''' ++ for contig, refseq in list(self.mCoverages.items()): ++ refcolumns = sum(refseq) ++ for pos, refcov in enumerate( refseq ): ++ columns = list(self.samfile.pileup( contig, pos, pos+1) ) ++ if refcov == 0: ++ # if no read, no coverage ++ self.assertEqual( len(columns), refcov, "wrong number of pileup columns returned for position %s:%i, %i should be %i" %(contig,pos,len(columns), refcov) ) ++ elif refcov == 1: ++ # one read, all columns of the read are returned ++ self.assertEqual( len(columns), refcolumns, "pileup incomplete at position %i: got %i, expected %i " %\ ++ (pos, len(columns), refcolumns)) ++ ++ def testIterateTruncate( self ): ++ '''check random access per range''' ++ for contig, length in zip(self.samfile.references, self.samfile.lengths): ++ for start in range( 1, length, 90): ++ self.checkRange( contig, start, start + 90, truncate = True ) # this includes empty ranges ++ ++ def tearDown(self): ++ self.samfile.close() ++ ++class TestIteratorColumn2(unittest.TestCase): ++ '''test iterator column against contents of ex1.bam.''' ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex1.bam","rb" ) ++ ++ def testStart( self ): ++ #print self.samfile.fetch().next().pos ++ #print self.samfile.pileup().next().pos ++ pass ++ ++ def testTruncate( self ): ++ '''see issue 107.''' ++ # note that ranges in regions start from 1 ++ p = self.samfile.pileup(region='chr1:170:172', truncate=True) ++ columns = [ x.pos for x in p ] ++ self.assertEqual( len(columns), 3) ++ self.assertEqual( columns, [169,170,171] ) ++ ++ p = self.samfile.pileup( 'chr1', 169, 172, truncate=True) ++ columns = [ x.pos for x in p ] ++ ++ self.assertEqual( len(columns), 3) ++ self.assertEqual( columns, [169,170,171] ) ++ ++class TestAlignedReadFromBam(unittest.TestCase): ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex3.bam","rb" ) ++ self.reads=list(self.samfile.fetch()) ++ ++ def testARqname(self): ++ self.assertEqual( self.reads[0].qname, "read_28833_29006_6945", "read name mismatch in read 1: %s != %s" % (self.reads[0].qname, "read_28833_29006_6945") ) ++ self.assertEqual( self.reads[1].qname, "read_28701_28881_323b", "read name mismatch in read 2: %s != %s" % (self.reads[1].qname, "read_28701_28881_323b") ) ++ ++ def testARflag(self): ++ self.assertEqual( self.reads[0].flag, 99, "flag mismatch in read 1: %s != %s" % (self.reads[0].flag, 99) ) ++ self.assertEqual( self.reads[1].flag, 147, "flag mismatch in read 2: %s != %s" % (self.reads[1].flag, 147) ) ++ ++ def testARrname(self): ++ self.assertEqual( self.reads[0].rname, 0, "chromosome/target id mismatch in read 1: %s != %s" % (self.reads[0].rname, 0) ) ++ self.assertEqual( self.reads[1].rname, 1, "chromosome/target id mismatch in read 2: %s != %s" % (self.reads[1].rname, 1) ) ++ ++ def testARpos(self): ++ self.assertEqual( self.reads[0].pos, 33-1, "mapping position mismatch in read 1: %s != %s" % (self.reads[0].pos, 33-1) ) ++ self.assertEqual( self.reads[1].pos, 88-1, "mapping position mismatch in read 2: %s != %s" % (self.reads[1].pos, 88-1) ) ++ ++ def testARmapq(self): ++ self.assertEqual( self.reads[0].mapq, 20, "mapping quality mismatch in read 1: %s != %s" % (self.reads[0].mapq, 20) ) ++ self.assertEqual( self.reads[1].mapq, 30, "mapping quality mismatch in read 2: %s != %s" % (self.reads[1].mapq, 30) ) ++ ++ def testARcigar(self): ++ self.assertEqual( self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)], "read name length mismatch in read 1: %s != %s" % (self.reads[0].cigar, [(0, 10), (2, 1), (0, 25)]) ) ++ self.assertEqual( self.reads[1].cigar, [(0, 35)], "read name length mismatch in read 2: %s != %s" % (self.reads[1].cigar, [(0, 35)]) ) ++ ++ def testARcigarstring(self): ++ self.assertEqual( self.reads[0].cigarstring, '10M1D25M' ) ++ self.assertEqual( self.reads[1].cigarstring, '35M' ) ++ ++ def testARmrnm(self): ++ self.assertEqual( self.reads[0].mrnm, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].mrnm, 0) ) ++ self.assertEqual( self.reads[1].mrnm, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].mrnm, 1) ) ++ self.assertEqual( self.reads[0].rnext, 0, "mate reference sequence name mismatch in read 1: %s != %s" % (self.reads[0].rnext, 0) ) ++ self.assertEqual( self.reads[1].rnext, 1, "mate reference sequence name mismatch in read 2: %s != %s" % (self.reads[1].rnext, 1) ) ++ ++ def testARmpos(self): ++ self.assertEqual( self.reads[0].mpos, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].mpos, 200-1) ) ++ self.assertEqual( self.reads[1].mpos, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].mpos, 500-1) ) ++ self.assertEqual( self.reads[0].pnext, 200-1, "mate mapping position mismatch in read 1: %s != %s" % (self.reads[0].pnext, 200-1) ) ++ self.assertEqual( self.reads[1].pnext, 500-1, "mate mapping position mismatch in read 2: %s != %s" % (self.reads[1].pnext, 500-1) ) ++ ++ def testARisize(self): ++ self.assertEqual( self.reads[0].isize, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].isize, 167) ) ++ self.assertEqual( self.reads[1].isize, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].isize, 412) ) ++ self.assertEqual( self.reads[0].tlen, 167, "insert size mismatch in read 1: %s != %s" % (self.reads[0].tlen, 167) ) ++ self.assertEqual( self.reads[1].tlen, 412, "insert size mismatch in read 2: %s != %s" % (self.reads[1].tlen, 412) ) ++ ++ def testARseq(self): ++ self.assertEqual( self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 1: %s != %s" % (self.reads[0].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") ) ++ self.assertEqual( self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "sequence size mismatch in read 2: %s != %s" % (self.reads[1].seq, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") ) ++ self.assertEqual( self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "sequence mismatch in read 4: %s != %s" % (self.reads[3].seq, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") ) ++ ++ def testARqual(self): ++ self.assertEqual( self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 1: %s != %s" % (self.reads[0].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") ) ++ self.assertEqual( self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "quality string mismatch in read 2: %s != %s" % (self.reads[1].qual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") ) ++ self.assertEqual( self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "quality string mismatch in read 3: %s != %s" % (self.reads[3].qual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") ) ++ ++ def testARquery(self): ++ self.assertEqual( self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG", "query mismatch in read 1: %s != %s" % (self.reads[0].query, b"AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG") ) ++ self.assertEqual( self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA", "query size mismatch in read 2: %s != %s" % (self.reads[1].query, b"ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA") ) ++ self.assertEqual( self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT", "query mismatch in read 4: %s != %s" % (self.reads[3].query, b"TAGCTAGCTACCTATATCTTGGTCTT") ) ++ ++ def testARqqual(self): ++ self.assertEqual( self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<", "qquality string mismatch in read 1: %s != %s" % (self.reads[0].qqual, b"<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<") ) ++ self.assertEqual( self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<", "qquality string mismatch in read 2: %s != %s" % (self.reads[1].qqual, b"<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<") ) ++ self.assertEqual( self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22", "qquality string mismatch in read 3: %s != %s" % (self.reads[3].qqual, b"<<<<<<<<<<<<<<<<<:<9/,&,22") ) ++ ++ def testPresentOptionalFields(self): ++ self.assertEqual( self.reads[0].opt('NM'), 1, "optional field mismatch in read 1, NM: %s != %s" % (self.reads[0].opt('NM'), 1) ) ++ self.assertEqual( self.reads[0].opt('RG'), 'L1', "optional field mismatch in read 1, RG: %s != %s" % (self.reads[0].opt('RG'), 'L1') ) ++ self.assertEqual( self.reads[1].opt('RG'), 'L2', "optional field mismatch in read 2, RG: %s != %s" % (self.reads[1].opt('RG'), 'L2') ) ++ self.assertEqual( self.reads[1].opt('MF'), 18, "optional field mismatch in read 2, MF: %s != %s" % (self.reads[1].opt('MF'), 18) ) ++ ++ def testPairedBools(self): ++ self.assertEqual( self.reads[0].is_paired, True, "is paired mismatch in read 1: %s != %s" % (self.reads[0].is_paired, True) ) ++ self.assertEqual( self.reads[1].is_paired, True, "is paired mismatch in read 2: %s != %s" % (self.reads[1].is_paired, True) ) ++ self.assertEqual( self.reads[0].is_proper_pair, True, "is proper pair mismatch in read 1: %s != %s" % (self.reads[0].is_proper_pair, True) ) ++ self.assertEqual( self.reads[1].is_proper_pair, True, "is proper pair mismatch in read 2: %s != %s" % (self.reads[1].is_proper_pair, True) ) ++ ++ def testTags( self ): ++ self.assertEqual( self.reads[0].tags, ++ [('NM', 1), ('RG', 'L1'), ++ ('PG', 'P1'), ('XT', 'U')] ) ++ self.assertEqual( self.reads[1].tags, ++ [('MF', 18), ('RG', 'L2'), ++ ('PG', 'P2'),('XT', 'R') ] ) ++ ++ def testOpt( self ): ++ self.assertEqual( self.reads[0].opt("XT"), "U" ) ++ self.assertEqual( self.reads[1].opt("XT"), "R" ) ++ ++ def testMissingOpt( self ): ++ self.assertRaises( KeyError, self.reads[0].opt, "XP" ) ++ ++ def testEmptyOpt( self ): ++ self.assertRaises( KeyError, self.reads[2].opt, "XT" ) ++ ++ def tearDown(self): ++ self.samfile.close() ++ ++class TestAlignedReadFromSam(TestAlignedReadFromBam): ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex3.sam","r" ) ++ self.reads=list(self.samfile.fetch()) ++ ++# needs to be implemented ++# class TestAlignedReadFromSamWithoutHeader(TestAlignedReadFromBam): ++# ++# def setUp(self): ++# self.samfile=pysam.Samfile( "ex7.sam","r" ) ++# self.reads=list(self.samfile.fetch()) ++ ++class TestHeaderSam(unittest.TestCase): ++ ++ header = {'SQ': [{'LN': 1575, 'SN': 'chr1'}, ++ {'LN': 1584, 'SN': 'chr2'}], ++ 'RG': [{'LB': 'SC_1', 'ID': 'L1', 'SM': 'NA12891', 'PU': 'SC_1_10', "CN":"name:with:colon"}, ++ {'LB': 'SC_2', 'ID': 'L2', 'SM': 'NA12891', 'PU': 'SC_2_12', "CN":"name:with:colon"}], ++ 'PG': [{'ID': 'P1', 'VN': '1.0'}, {'ID': 'P2', 'VN': '1.1'}], ++ 'HD': {'VN': '1.0'}, ++ 'CO' : [ 'this is a comment', 'this is another comment'], ++ } ++ ++ def compareHeaders( self, a, b ): ++ '''compare two headers a and b.''' ++ for ak,av in a.items(): ++ self.assertTrue( ak in b, "key '%s' not in '%s' " % (ak,b) ) ++ self.assertEqual( av, b[ak] ) ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex3.sam","r" ) ++ ++ def testHeaders(self): ++ self.compareHeaders( self.header, self.samfile.header ) ++ self.compareHeaders( self.samfile.header, self.header ) ++ ++ def testNameMapping( self ): ++ for x, y in enumerate( ("chr1", "chr2")): ++ tid = self.samfile.gettid( y ) ++ ref = self.samfile.getrname( x ) ++ self.assertEqual( tid, x ) ++ self.assertEqual( ref, y ) ++ ++ self.assertEqual( self.samfile.gettid("chr?"), -1 ) ++ self.assertRaises( ValueError, self.samfile.getrname, 2 ) ++ ++ def tearDown(self): ++ self.samfile.close() ++ ++class TestHeaderBam(TestHeaderSam): ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex3.bam","rb" ) ++ ++ ++class TestHeader1000Genomes( unittest.TestCase ): ++ ++ # bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase2b_alignment/data/NA07048/exome_alignment/NA07048.unmapped.ILLUMINA.bwa.CEU.exome.20120522_p2b.bam" ++ bamfile = "http://ftp.1000genomes.ebi.ac.uk/vol1/ftp/technical/phase3_EX_or_LC_only_alignment/data/HG00104/alignment/HG00104.chrom11.ILLUMINA.bwa.GBR.low_coverage.20130415.bam" ++ ++ def testRead( self ): ++ ++ # Skip fetching files from web when building the package ++ #f = pysam.Samfile( self.bamfile, "rb" ) ++ #data = f.header.copy() ++ #self.assertTrue( data ) ++ self.assertTrue( True ) ++ ++class TestUnmappedReads(unittest.TestCase): ++ ++ def testSAM(self): ++ samfile=pysam.Samfile( "ex5.sam","r" ) ++ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 ) ++ samfile.close() ++ ++ def testBAM(self): ++ samfile=pysam.Samfile( "ex5.bam","rb" ) ++ self.assertEqual( len(list(samfile.fetch( until_eof = True))), 2 ) ++ samfile.close() ++ ++class TestPileupObjects(unittest.TestCase): ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex1.bam","rb" ) ++ ++ def testPileupColumn(self): ++ for pcolumn1 in self.samfile.pileup( region="chr1:105" ): ++ if pcolumn1.pos == 104: ++ self.assertEqual( pcolumn1.tid, 0, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn1.tid, 0) ) ++ self.assertEqual( pcolumn1.pos, 105-1, "position mismatch in position 1: %s != %s" % (pcolumn1.pos, 105-1) ) ++ self.assertEqual( pcolumn1.n, 2, "# reads mismatch in position 1: %s != %s" % (pcolumn1.n, 2) ) ++ for pcolumn2 in self.samfile.pileup( region="chr2:1480" ): ++ if pcolumn2.pos == 1479: ++ self.assertEqual( pcolumn2.tid, 1, "chromosome/target id mismatch in position 1: %s != %s" % (pcolumn2.tid, 1) ) ++ self.assertEqual( pcolumn2.pos, 1480-1, "position mismatch in position 1: %s != %s" % (pcolumn2.pos, 1480-1) ) ++ self.assertEqual( pcolumn2.n, 12, "# reads mismatch in position 1: %s != %s" % (pcolumn2.n, 12) ) ++ ++ def testPileupRead(self): ++ for pcolumn1 in self.samfile.pileup( region="chr1:105" ): ++ if pcolumn1.pos == 104: ++ self.assertEqual( len(pcolumn1.pileups), 2, "# reads aligned to column mismatch in position 1: %s != %s" % (len(pcolumn1.pileups), 2) ) ++# self.assertEqual( pcolumn1.pileups[0] # need to test additional properties here ++ ++ def tearDown(self): ++ self.samfile.close() ++ ++ def testIteratorOutOfScope( self ): ++ '''test if exception is raised if pileup col is accessed after iterator is exhausted.''' ++ ++ for pileupcol in self.samfile.pileup(): ++ pass ++ ++ self.assertRaises( ValueError, getattr, pileupcol, "pileups" ) ++ ++class TestContextManager(unittest.TestCase): ++ ++ def testManager( self ): ++ with pysam.Samfile('ex1.bam', 'rb') as samfile: ++ samfile.fetch() ++ self.assertEqual( samfile._isOpen(), False ) ++ ++class TestExceptions(unittest.TestCase): ++ ++ def setUp(self): ++ self.samfile=pysam.Samfile( "ex1.bam","rb" ) ++ ++ def testMissingFile(self): ++ ++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "rb" ) ++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "r" ) ++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.bam", "r" ) ++ self.assertRaises( IOError, pysam.Samfile, "exdoesntexist.sam", "rb" ) ++ ++ def testBadContig(self): ++ self.assertRaises( ValueError, self.samfile.fetch, "chr88" ) ++ ++ def testMeaninglessCrap(self): ++ self.assertRaises( ValueError, self.samfile.fetch, "skljf" ) ++ ++ def testBackwardsOrderNewFormat(self): ++ self.assertRaises( ValueError, self.samfile.fetch, 'chr1', 100, 10 ) ++ ++ def testBackwardsOrderOldFormat(self): ++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:100-10") ++ ++ def testOutOfRangeNegativeNewFormat(self): ++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, -10 ) ++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 5, 0 ) ++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", -5, -10 ) ++ ++ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, -10 ) ++ self.assertRaises( ValueError, self.samfile.count, "chr1", 5, 0 ) ++ self.assertRaises( ValueError, self.samfile.count, "chr1", -5, -10 ) ++ ++ def testOutOfRangeNegativeOldFormat(self): ++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-10" ) ++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5-0" ) ++ self.assertRaises( ValueError, self.samfile.fetch, region="chr1:-5--10" ) ++ ++ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-10" ) ++ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5-0" ) ++ self.assertRaises( ValueError, self.samfile.count, region="chr1:-5--10" ) ++ ++ def testOutOfRangNewFormat(self): ++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999, 99999999999 ) ++ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999, 99999999999 ) ++ ++ def testOutOfRangeLargeNewFormat(self): ++ self.assertRaises( ValueError, self.samfile.fetch, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 ) ++ self.assertRaises( ValueError, self.samfile.count, "chr1", 9999999999999999999999999999999, 9999999999999999999999999999999999999999 ) ++ ++ def testOutOfRangeLargeOldFormat(self): ++ self.assertRaises( ValueError, self.samfile.fetch, "chr1:99999999999999999-999999999999999999" ) ++ self.assertRaises( ValueError, self.samfile.count, "chr1:99999999999999999-999999999999999999" ) ++ ++ def testZeroToZero(self): ++ '''see issue 44''' ++ self.assertEqual( len(list(self.samfile.fetch('chr1', 0, 0))), 0) ++ ++ def tearDown(self): ++ self.samfile.close() ++ ++class TestWrongFormat(unittest.TestCase): ++ '''test cases for opening files not in bam/sam format.''' ++ ++ def testOpenSamAsBam( self ): ++ self.assertRaises( ValueError, pysam.Samfile, 'ex1.sam', 'rb' ) ++ ++ def testOpenBamAsSam( self ): ++ # test fails, needs to be implemented. ++ # sam.fetch() fails on reading, not on opening ++ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.bam', 'r' ) ++ pass ++ ++ def testOpenFastaAsSam( self ): ++ # test fails, needs to be implemented. ++ # sam.fetch() fails on reading, not on opening ++ # self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'r' ) ++ pass ++ ++ def testOpenFastaAsBam( self ): ++ self.assertRaises( ValueError, pysam.Samfile, 'ex1.fa', 'rb' ) ++ ++class TestFastaFile(unittest.TestCase): ++ ++ mSequences = { 'chr1' : ++ b"CACTAGTGGCTCATTGTAAATGTGTGGTTTAACTCGTCCATGGCCCAGCATTAGGGAGCTGTGGACCCTGCAGCCTGGCTGTGGGGGCCGCAGTGGCTGAGGGGTGCAGAGCCGAGTCACGGGGTTGCCAGCACAGGGGCTTAACCTCTGGTGACTGCCAGAGCTGCTGGCAAGCTAGAGTCCCATTTGGAGCCCCTCTAAGCCGTTCTATTTGTAATGAAAACTATATTTATGCTATTCAGTTCTAAATATAGAAATTGAAACAGCTGTGTTTAGTGCCTTTGTTCAACCCCCTTGCAACAACCTTGAGAACCCCAGGGAATTTGTCAATGTCAGGGAAGGAGCATTTTGTCAGTTACCAAATGTGTTTATTACCAGAGGGATGGAGGGAAGAGGGACGCTGAAGAACTTTGATGCCCTCTTCTTCCAAAGATGAAACGCGTAACTGCGCTCTCATTCACTCCAGCTCCCTGTCACCCAATGGACCTGTGATATCTGGATTCTGGGAAATTCTTCATCCTGGACCCTGAGAGATTCTGCAGCCCAGCTCCAGATTGCTTGTGGTCTGACAGGCTGCAACTGTGAGCCATCACAATGAACAACAGGAAGAAAAGGTCTTTCAAAAGGTGATGTGTGTTCTCATCAACCTCATACACACACATGGTTTAGGGGTATAATACCTCTACATGGCTGATTATGAAAACAATGTTCCCCAGATACCATCCCTGTCTTACTTCCAGCTCCCCAGAGGGAAAGCTTTCAACGCTTCTAGCCATTTCTTTTGGCATTTGCCTTCAGACCCTACACGAATGCGTCTCTACCACAGGGGGCTGCGCGGTTTCCCATCATGAAGCACTGAACTTCCACGTCTCATCTAGGGGAACAGGGAGGTGCACTAATGCGCTCCACGCCCAAGCCCTTCTCACAGTTTCTGCCCCCAGCATGGTTGTACTGGGCAATACATGAGATTATTAGGAAATGCTTTACTGTCATAACTATGAAGAGACTATTGCCAGATGAACCACACATTAATACTATGTTTCTTATCTGCACATTACTACCCTGCAATTAATATAATTGTGTCCATGTACACACGCTGTCCTATGTACTTATCATGACTCTATCCCAAATTCCCAATTACGTCCTATCTTCTTCTTAGGGAAGAACAGCTTAGGTATCAATTTGGTGTTCTGTGTAAAGTCTCAGGGAGCCGTCCGTGTCCTCCCATCTGGCCTCGTCCACACTGGTTCTCTTGAAAGCTTGGGCTGTAATGATGCCCCTTGGCCATCACCCAGTCCCTGCCCCATCTCTTGTAATCTCTCTCCTTTTTGCTGCATCCCTGTCTTCCTCTGTCTTGATTTACTTGTTGTTGGTTTTCTGTTTCTTTGTTTGATTTGGTGGAAGACATAATCCCACGCTTCCTATGGAAAGGTTGTTGGGAGATTTTTAATGATTCCTCAATGTTAAAATGTCTATTTTTGTCTTGACACCCAACTAATATTTGTCTGAGCAAAACAGTCTAGATGAGAGAGAACTTCCCTGGAGGTCTGATGGCGTTTCTCCCTCGTCTTCTTA", ++ 'chr2' : ++ b"TTCAAATGAACTTCTGTAATTGAAAAATTCATTTAAGAAATTACAAAATATAGTTGAAAGCTCTAACAATAGACTAAACCAAGCAGAAGAAAGAGGTTCAGAACTTGAAGACAAGTCTCTTATGAATTAACCCAGTCAGACAAAAATAAAGAAAAAAATTTTAAAAATGAACAGAGCTTTCAAGAAGTATGAGATTATGTAAAGTAACTGAACCTATGAGTCACAGGTATTCCTGAGGAAAAAGAAAAAGTGAGAAGTTTGGAAAAACTATTTGAGGAAGTAATTGGGGAAAACCTCTTTAGTCTTGCTAGAGATTTAGACATCTAAATGAAAGAGGCTCAAAGAATGCCAGGAAGATACATTGCAAGACAGACTTCATCAAGATATGTAGTCATCAGACTATCTAAAGTCAACATGAAGGAAAAAAATTCTAAAATCAGCAAGAGAAAAGCATACAGTCATCTATAAAGGAAATCCCATCAGAATAACAATGGGCTTCTCAGCAGAAACCTTACAAGCCAGAAGAGATTGGATCTAATTTTTGGACTTCTTAAAGAAAAAAAAACCTGTCAAACACGAATGTTATGCCCTGCTAAACTAAGCATCATAAATGAAGGGGAAATAAAGTCAAGTCTTTCCTGACAAGCAAATGCTAAGATAATTCATCATCACTAAACCAGTCCTATAAGAAATGCTCAAAAGAATTGTAAAAGTCAAAATTAAAGTTCAATACTCACCATCATAAATACACACAAAAGTACAAAACTCACAGGTTTTATAAAACAATTGAGACTACAGAGCAACTAGGTAAAAAATTAACATTACAACAGGAACAAAACCTCATATATCAATATTAACTTTGAATAAAAAGGGATTAAATTCCCCCACTTAAGAGATATAGATTGGCAGAACAGATTTAAAAACATGAACTAACTATATGCTGTTTACAAGAAACTCATTAATAAAGACATGAGTTCAGGTAAAGGGGTGGAAAAAGATGTTCTACGCAAACAGAAACCAAATGAGAGAAGGAGTAGCTATACTTATATCAGATAAAGCACACTTTAAATCAACAACAGTAAAATAAAACAAAGGAGGTCATCATACAATGATAAAAAGATCAATTCAGCAAGAAGATATAACCATCCTACTAAATACATATGCACCTAACACAAGACTACCCAGATTCATAAAACAAATACTACTAGACCTAAGAGGGATGAGAAATTACCTAATTGGTACAATGTACAATATTCTGATGATGGTTACACTAAAAGCCCATACTTTACTGCTACTCAATATATCCATGTAACAAATCTGCGCTTGTACTTCTAAATCTATAAAAAAATTAAAATTTAACAAAAGTAAATAAAACACATAGCTAAAACTAAAAAAGCAAAAACAAAAACTATGCTAAGTATTGGTAAAGATGTGGGGAAAAAAGTAAACTCTCAAATATTGCTAGTGGGAGTATAAATTGTTTTCCACTTTGGAAAACAATTTGGTAATTTCGTTTTTTTTTTTTTCTTTTCTCTTTTTTTTTTTTTTTTTTTTGCATGCCAGAAAAAAATATTTACAGTAACT", ++ } ++ ++ def setUp(self): ++ self.file=pysam.Fastafile( "ex1.fa" ) ++ ++ def testFetch(self): ++ for id, seq in list(self.mSequences.items()): ++ self.assertEqual( seq, self.file.fetch( id ) ) ++ for x in range( 0, len(seq), 10): ++ self.assertEqual( seq[x:x+10], self.file.fetch( id, x, x+10) ) ++ # test x:end ++ self.assertEqual( seq[x:], self.file.fetch( id, x) ) ++ # test 0:x ++ self.assertEqual( seq[:x], self.file.fetch( id, None, x) ) ++ ++ ++ # unknown sequence returns "" ++ self.assertEqual( b"", self.file.fetch("chr12") ) ++ ++ def testOutOfRangeAccess( self ): ++ '''test out of range access.''' ++ # out of range access returns an empty string ++ for contig, s in self.mSequences.items(): ++ self.assertEqual( self.file.fetch( contig, len(s), len(s)+1), b"" ) ++ ++ self.assertEqual( self.file.fetch( "chr3", 0 , 100), b"" ) ++ ++ def testFetchErrors( self ): ++ self.assertRaises( ValueError, self.file.fetch ) ++ self.assertRaises( ValueError, self.file.fetch, "chr1", -1, 10 ) ++ self.assertRaises( ValueError, self.file.fetch, "chr1", 20, 10 ) ++ ++ def testLength( self ): ++ self.assertEqual( len(self.file), 2 ) ++ ++ def tearDown(self): ++ self.file.close() ++ ++class TestAlignedRead(unittest.TestCase): ++ '''tests to check if aligned read can be constructed ++ and manipulated. ++ ''' ++ ++ def checkFieldEqual( self, read1, read2, exclude = []): ++ '''check if two reads are equal by comparing each field.''' ++ ++ for x in ("qname", "seq", "flag", ++ "rname", "pos", "mapq", "cigar", ++ "mrnm", "mpos", "isize", "qual", ++ "is_paired", "is_proper_pair", ++ "is_unmapped", "mate_is_unmapped", ++ "is_reverse", "mate_is_reverse", ++ "is_read1", "is_read2", ++ "is_secondary", "is_qcfail", ++ "is_duplicate", "bin"): ++ if x in exclude: continue ++ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" % ++ (x, getattr(read1, x), getattr(read2,x))) ++ ++ def testEmpty( self ): ++ a = pysam.AlignedRead() ++ self.assertEqual( a.qname, None ) ++ self.assertEqual( a.seq, None ) ++ self.assertEqual( a.qual, None ) ++ self.assertEqual( a.flag, 0 ) ++ self.assertEqual( a.rname, 0 ) ++ self.assertEqual( a.mapq, 0 ) ++ self.assertEqual( a.cigar, None ) ++ self.assertEqual( a.tags, [] ) ++ self.assertEqual( a.mrnm, 0 ) ++ self.assertEqual( a.mpos, 0 ) ++ self.assertEqual( a.isize, 0 ) ++ ++ def buildRead( self ): ++ '''build an example read.''' ++ ++ a = pysam.AlignedRead() ++ a.qname = "read_12345" ++ a.seq="ACGT" * 10 ++ a.flag = 0 ++ a.rname = 0 ++ a.pos = 20 ++ a.mapq = 20 ++ a.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) ) ++ a.mrnm = 0 ++ a.mpos=200 ++ a.isize=167 ++ a.qual="1234" * 10 ++ # todo: create tags ++ return a ++ ++ def testUpdate( self ): ++ '''check if updating fields affects other variable length data ++ ''' ++ a = self.buildRead() ++ b = self.buildRead() ++ ++ # check qname ++ b.qname = "read_123" ++ self.checkFieldEqual( a, b, "qname" ) ++ b.qname = "read_12345678" ++ self.checkFieldEqual( a, b, "qname" ) ++ b.qname = "read_12345" ++ self.checkFieldEqual( a, b) ++ ++ # check cigar ++ b.cigar = ( (0,10), ) ++ self.checkFieldEqual( a, b, "cigar" ) ++ b.cigar = ( (0,10), (2,1), (0,10) ) ++ self.checkFieldEqual( a, b, "cigar" ) ++ b.cigar = ( (0,10), (2,1), (0,9), (1,1), (0,20) ) ++ self.checkFieldEqual( a, b) ++ ++ # check seq ++ b.seq = "ACGT" ++ self.checkFieldEqual( a, b, ("seq", "qual") ) ++ b.seq = "ACGT" * 3 ++ self.checkFieldEqual( a, b, ("seq", "qual") ) ++ b.seq = "ACGT" * 10 ++ self.checkFieldEqual( a, b, ("qual",)) ++ ++ # reset qual ++ b = self.buildRead() ++ ++ # check flags: ++ for x in ( ++ "is_paired", "is_proper_pair", ++ "is_unmapped", "mate_is_unmapped", ++ "is_reverse", "mate_is_reverse", ++ "is_read1", "is_read2", ++ "is_secondary", "is_qcfail", ++ "is_duplicate"): ++ setattr( b, x, True ) ++ self.assertEqual( getattr(b, x), True ) ++ self.checkFieldEqual( a, b, ("flag", x,) ) ++ setattr( b, x, False ) ++ self.assertEqual( getattr(b, x), False ) ++ self.checkFieldEqual( a, b ) ++ ++ def testLargeRead( self ): ++ '''build an example read.''' ++ ++ a = pysam.AlignedRead() ++ a.qname = "read_12345" ++ a.seq="ACGT" * 200 ++ a.flag = 0 ++ a.rname = 0 ++ a.pos = 20 ++ a.mapq = 20 ++ a.cigar = ( (0, 4 * 200), ) ++ a.mrnm = 0 ++ a.mpos=200 ++ a.isize=167 ++ a.qual="1234" * 200 ++ ++ return a ++ ++ def testTagParsing( self ): ++ '''test for tag parsing ++ ++ see http://groups.google.com/group/pysam-user-group/browse_thread/thread/67ca204059ea465a ++ ''' ++ samfile=pysam.Samfile( "ex8.bam","rb" ) ++ ++ for entry in samfile: ++ before = entry.tags ++ entry.tags = entry.tags ++ after = entry.tags ++ self.assertEqual( after, before ) ++ ++ def testUpdateTlen( self ): ++ '''check if updating tlen works''' ++ a = self.buildRead() ++ oldlen = a.tlen ++ oldlen *= 2 ++ a.tlen = oldlen ++ self.assertEqual( a.tlen, oldlen ) ++ ++ def testPositions( self ): ++ a = self.buildRead() ++ self.assertEqual( a.positions, ++ [20, 21, 22, 23, 24, 25, 26, 27, 28, 29, ++ 31, 32, 33, 34, 35, 36, 37, 38, 39, ++ 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, ++ 50, 51, 52, 53, 54, 55, 56, 57, 58, 59] ) ++ ++ self.assertEqual( a.aligned_pairs, ++ [(0, 20), (1, 21), (2, 22), (3, 23), (4, 24), ++ (5, 25), (6, 26), (7, 27), (8, 28), (9, 29), ++ (None, 30), ++ (10, 31), (11, 32), (12, 33), (13, 34), (14, 35), ++ (15, 36), (16, 37), (17, 38), (18, 39), (19, None), ++ (20, 40), (21, 41), (22, 42), (23, 43), (24, 44), ++ (25, 45), (26, 46), (27, 47), (28, 48), (29, 49), ++ (30, 50), (31, 51), (32, 52), (33, 53), (34, 54), ++ (35, 55), (36, 56), (37, 57), (38, 58), (39, 59)] ) ++ ++ self.assertEqual( a.positions, [x[1] for x in a.aligned_pairs if x[0] != None and x[1] != None] ) ++ # alen is the length of the aligned read in genome ++ self.assertEqual( a.alen, a.aligned_pairs[-1][0] + 1 ) ++ # aend points to one beyond last aligned base in ref ++ self.assertEqual( a.positions[-1], a.aend - 1 ) ++ ++class TestDeNovoConstruction(unittest.TestCase): ++ '''check BAM/SAM file construction using ex6.sam ++ ++ (note these are +1 coordinates): ++ ++ read_28833_29006_6945 99 chr1 33 20 10M1D25M = 200 167 AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG <<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<< NM:i:1 RG:Z:L1 ++ read_28701_28881_323b 147 chr2 88 30 35M = 500 412 ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA <<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<< MF:i:18 RG:Z:L2 ++ ''' ++ ++ header = { 'HD': {'VN': '1.0'}, ++ 'SQ': [{'LN': 1575, 'SN': 'chr1'}, ++ {'LN': 1584, 'SN': 'chr2'}], } ++ ++ bamfile = "ex6.bam" ++ samfile = "ex6.sam" ++ ++ def checkFieldEqual( self, read1, read2, exclude = []): ++ '''check if two reads are equal by comparing each field.''' ++ ++ for x in ("qname", "seq", "flag", ++ "rname", "pos", "mapq", "cigar", ++ "mrnm", "mpos", "isize", "qual", ++ "bin", ++ "is_paired", "is_proper_pair", ++ "is_unmapped", "mate_is_unmapped", ++ "is_reverse", "mate_is_reverse", ++ "is_read1", "is_read2", ++ "is_secondary", "is_qcfail", ++ "is_duplicate"): ++ if x in exclude: continue ++ self.assertEqual( getattr(read1, x), getattr(read2,x), "attribute mismatch for %s: %s != %s" % ++ (x, getattr(read1, x), getattr(read2,x))) ++ ++ def setUp( self ): ++ ++ a = pysam.AlignedRead() ++ a.qname = "read_28833_29006_6945" ++ a.seq="AGCTTAGCTAGCTACCTATATCTTGGTCTTGGCCG" ++ a.flag = 99 ++ a.rname = 0 ++ a.pos = 32 ++ a.mapq = 20 ++ a.cigar = ( (0,10), (2,1), (0,25) ) ++ a.mrnm = 0 ++ a.mpos=199 ++ a.isize=167 ++ a.qual="<<<<<<<<<<<<<<<<<<<<<:<9/,&,22;;<<<" ++ a.tags = ( ("NM", 1), ++ ("RG", "L1") ) ++ ++ b = pysam.AlignedRead() ++ b.qname = "read_28701_28881_323b" ++ b.seq="ACCTATATCTTGGCCTTGGCCGATGCGGCCTTGCA" ++ b.flag = 147 ++ b.rname = 1 ++ b.pos = 87 ++ b.mapq = 30 ++ b.cigar = ( (0,35), ) ++ b.mrnm = 1 ++ b.mpos=499 ++ b.isize=412 ++ b.qual="<<<<<;<<<<7;:<<<6;<<<<<<<<<<<<7<<<<" ++ b.tags = ( ("MF", 18), ++ ("RG", "L2") ) ++ ++ self.reads = (a,b) ++ ++ def testSAMWholeFile( self ): ++ ++ tmpfilename = "tmp_%i.sam" % id(self) ++ ++ outfile = pysam.Samfile( tmpfilename, "wh", header = self.header ) ++ ++ for x in self.reads: outfile.write( x ) ++ outfile.close() ++ self.assertTrue( checkBinaryEqual( tmpfilename, self.samfile ), ++ "mismatch when construction SAM file, see %s %s" % (tmpfilename, self.samfile)) ++ ++ os.unlink( tmpfilename ) ++ ++ def testBAMPerRead( self ): ++ '''check if individual reads are binary equal.''' ++ infile = pysam.Samfile( self.bamfile, "rb") ++ ++ others = list(infile) ++ for denovo, other in zip( others, self.reads): ++ self.checkFieldEqual( other, denovo ) ++ self.assertEqual( other.compare( denovo ), 0 ) ++ ++ def testSAMPerRead( self ): ++ '''check if individual reads are binary equal.''' ++ infile = pysam.Samfile( self.samfile, "r") ++ ++ others = list(infile) ++ for denovo, other in zip( others, self.reads): ++ self.checkFieldEqual( other, denovo ) ++ self.assertEqual( other.compare( denovo), 0 ) ++ ++ def testBAMWholeFile( self ): ++ ++ tmpfilename = "tmp_%i.bam" % id(self) ++ ++ outfile = pysam.Samfile( tmpfilename, "wb", header = self.header ) ++ ++ for x in self.reads: outfile.write( x ) ++ outfile.close() ++ ++ self.assertTrue( checkBinaryEqual( tmpfilename, self.bamfile ), ++ "mismatch when construction BAM file, see %s %s" % (tmpfilename, self.bamfile)) ++ ++ os.unlink( tmpfilename ) ++ ++class TestDeNovoConstructionUserTags(TestDeNovoConstruction): ++ '''test de novo construction with a header that contains lower-case tags.''' ++ ++ header = { 'HD': {'VN': '1.0'}, ++ 'SQ': [{'LN': 1575, 'SN': 'chr1'}, ++ {'LN': 1584, 'SN': 'chr2'}], ++ 'x1': {'A': 2, 'B': 5 }, ++ 'x3': {'A': 6, 'B': 5 }, ++ 'x2': {'A': 4, 'B': 5 } } ++ ++ bamfile = "example_user_header.bam" ++ samfile = "example_user_header.sam" ++ ++class TestEmptyHeader( unittest.TestCase ): ++ '''see issue 84.''' ++ ++ def testEmptyHeader( self ): ++ ++ s = pysam.Samfile('example_empty_header.bam') ++ self.assertEqual( s.header, {'SQ': [{'LN': 1000, 'SN': 'chr1'}]} ) ++ ++class TestBTagSam( unittest.TestCase ): ++ '''see issue 81.''' ++ ++ compare = [ [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95], ++ [-100,200,-300,-400], ++ [-100,12], ++ [12,15], ++ [-1.0,5.0,2.5] ] ++ ++ filename = 'example_btag.sam' ++ ++ def testRead( self ): ++ ++ s = pysam.Samfile(self.filename) ++ for x, read in enumerate(s): ++ if x == 0: ++ self.assertEqual( read.tags, [('RG', 'QW85I'), ('PG', 'tmap'), ('MD', '140'), ('NM', 0), ('AS', 140), ('FZ', [100, 1, 91, 0, 7, 101, 0, 201, 96, 204, 0, 0, 87, 109, 0, 7, 97, 112, 1, 12, 78, 197, 0, 7, 100, 95, 101, 202, 0, 6, 0, 1, 186, 0, 84, 0, 244, 0, 0, 324, 0, 107, 195, 101, 113, 0, 102, 0, 104, 3, 0, 101, 1, 0, 212, 6, 0, 0, 1, 0, 74, 1, 11, 0, 196, 2, 197, 103, 0, 108, 98, 2, 7, 0, 1, 2, 194, 0, 180, 0, 108, 0, 203, 104, 16, 5, 205, 0, 0, 0, 1, 1, 100, 98, 0, 0, 204, 6, 0, 79, 0, 0, 101, 7, 109, 90, 265, 1, 27, 10, 109, 102, 9, 0, 292, 0, 110, 0, 0, 102, 112, 0, 0, 84, 100, 103, 2, 81, 126, 0, 2, 90, 0, 15, 96, 15, 1, 0, 2, 0, 107, 92, 0, 0, 101, 3, 98, 15, 102, 13, 116, 116, 90, 93, 198, 0, 0, 0, 199, 92, 26, 495, 100, 5, 0, 100, 5, 209, 0, 92, 107, 90, 0, 0, 0, 0, 109, 194, 7, 94, 200, 0, 40, 197, 0, 11, 0, 0, 112, 110, 6, 4, 200, 28, 0, 196, 0, 203, 1, 129, 0, 0, 1, 0, 94, 0, 1, 0, 107, 5, 201, 3, 3, 100, 0, 121, 0, 7, 0, 1, 105, 306, 3, 86, 8, 183, 0, 12, 163, 17, 83, 22, 0, 0, 1, 8, 109, 103, 0, 0, 295, 0, 200, 16, 172, 3, 16, 182, 3, 11, 0, 0, 223, 111, 103, 0, 5, 225, 0, 95]), ('XA', 'map2-1'), ('XS', 53), ('XT', 38), ('XF', 1), ('XE', 0)] ++ ) ++ ++ fz = dict(read.tags)["FZ"] ++ self.assertEqual( fz, self.compare[x] ) ++ self.assertEqual( read.opt("FZ"), self.compare[x]) ++ ++ def testWrite( self ): ++ ++ s = pysam.Samfile(self.filename) ++ for read in s: ++ before = read.tags ++ read.tags = read.tags ++ after = read.tags ++ self.assertEqual( after, before ) ++ ++class TestBTagBam( TestBTagSam ): ++ filename = 'example_btag.bam' ++ ++class TestDoubleFetch(unittest.TestCase): ++ '''check if two iterators on the same bamfile are independent.''' ++ ++ def testDoubleFetch( self ): ++ ++ samfile1 = pysam.Samfile('ex1.bam', 'rb') ++ ++ for a,b in zip(samfile1.fetch(), samfile1.fetch()): ++ self.assertEqual( a.compare( b ), 0 ) ++ ++ def testDoubleFetchWithRegion( self ): ++ ++ samfile1 = pysam.Samfile('ex1.bam', 'rb') ++ chr, start, stop = 'chr1', 200, 3000000 ++ self.assertTrue(len(list(samfile1.fetch ( chr, start, stop))) > 0) #just making sure the test has something to catch ++ ++ for a,b in zip(samfile1.fetch( chr, start, stop), samfile1.fetch( chr, start, stop)): ++ self.assertEqual( a.compare( b ), 0 ) ++ ++ def testDoubleFetchUntilEOF( self ): ++ ++ samfile1 = pysam.Samfile('ex1.bam', 'rb') ++ ++ for a,b in zip(samfile1.fetch( until_eof = True), ++ samfile1.fetch( until_eof = True )): ++ self.assertEqual( a.compare( b), 0 ) ++ ++class TestRemoteFileFTP(unittest.TestCase): ++ '''test remote access. ++ ++ ''' ++ ++ # Need to find an ftp server without password on standard ++ # port. ++ ++ url = "ftp://ftp.sanger.ac.uk/pub/rd/humanSequences/CV.bam" ++ region = "1:1-1000" ++ ++ def testFTPView( self ): ++ return ++ result = pysam.view( self.url, self.region ) ++ self.assertEqual( len(result), 36 ) ++ ++ def testFTPFetch( self ): ++ return ++ samfile = pysam.Samfile(self.url, "rb") ++ result = list(samfile.fetch( region = self.region )) ++ self.assertEqual( len(result), 36 ) ++ ++class TestLargeOptValues( unittest.TestCase ): ++ ++ ints = ( 65536, 214748, 2147484, 2147483647 ) ++ floats = ( 65536.0, 214748.0, 2147484.0 ) ++ ++ def check( self, samfile ): ++ ++ i = samfile.fetch() ++ for exp in self.ints: ++ rr = next(i) ++ obs = rr.opt("ZP") ++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) ++ ++ for exp in [ -x for x in self.ints ]: ++ rr = next(i) ++ obs = rr.opt("ZP") ++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) ++ ++ for exp in self.floats: ++ rr = next(i) ++ obs = rr.opt("ZP") ++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) ++ ++ for exp in [ -x for x in self.floats ]: ++ rr = next(i) ++ obs = rr.opt("ZP") ++ self.assertEqual( exp, obs, "expected %s, got %s\n%s" % (str(exp), str(obs), str(rr))) ++ ++ def testSAM( self ): ++ samfile = pysam.Samfile("ex10.sam", "r") ++ self.check( samfile ) ++ ++ def testBAM( self ): ++ samfile = pysam.Samfile("ex10.bam", "rb") ++ self.check( samfile ) ++ ++# class TestSNPCalls( unittest.TestCase ): ++# '''test pysam SNP calling ability.''' ++ ++# def checkEqual( self, a, b ): ++# for x in ("reference_base", ++# "pos", ++# "genotype", ++# "consensus_quality", ++# "snp_quality", ++# "mapping_quality", ++# "coverage" ): ++# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" % ++# (x, getattr(a, x), getattr(b,x), str(a), str(b))) ++ ++# def testAllPositionsViaIterator( self ): ++# samfile = pysam.Samfile( "ex1.bam", "rb") ++# fastafile = pysam.Fastafile( "ex1.fa" ) ++# try: ++# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base != "*"] ++# except pysam.SamtoolsError: ++# pass ++ ++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile ) ++# calls = list(pysam.IteratorSNPCalls(i)) ++# for x,y in zip( refs, calls ): ++# self.checkEqual( x, y ) ++ ++# def testPerPositionViaIterator( self ): ++# # test pileup for each position. This is a slow operation ++# # so this test is disabled ++# return ++# samfile = pysam.Samfile( "ex1.bam", "rb") ++# fastafile = pysam.Fastafile( "ex1.fa" ) ++# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ): ++# if x.reference_base == "*": continue ++# i = samfile.pileup( x.chromosome, x.pos, x.pos+1, ++# fastafile = fastafile, ++# stepper = "samtools" ) ++# z = [ zz for zz in pysam.IteratorSamtools(i) if zz.pos == x.pos ] ++# self.assertEqual( len(z), 1 ) ++# self.checkEqual( x, z[0] ) ++ ++# def testPerPositionViaCaller( self ): ++# # test pileup for each position. This is a fast operation ++# samfile = pysam.Samfile( "ex1.bam", "rb") ++# fastafile = pysam.Fastafile( "ex1.fa" ) ++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile ) ++# caller = pysam.SNPCaller( i ) ++ ++# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ): ++# if x.reference_base == "*": continue ++# call = caller.call( x.chromosome, x.pos ) ++# self.checkEqual( x, call ) ++ ++# class TestIndelCalls( unittest.TestCase ): ++# '''test pysam indel calling.''' ++ ++# def checkEqual( self, a, b ): ++ ++# for x in ("pos", ++# "genotype", ++# "consensus_quality", ++# "snp_quality", ++# "mapping_quality", ++# "coverage", ++# "first_allele", ++# "second_allele", ++# "reads_first", ++# "reads_second", ++# "reads_diff"): ++# if b.genotype == "*/*" and x == "second_allele": ++# # ignore test for second allele (positions chr2:439 and chr2:1512) ++# continue ++# self.assertEqual( getattr(a, x), getattr(b,x), "%s mismatch: %s != %s\n%s\n%s" % ++# (x, getattr(a, x), getattr(b,x), str(a), str(b))) ++ ++# def testAllPositionsViaIterator( self ): ++ ++# samfile = pysam.Samfile( "ex1.bam", "rb") ++# fastafile = pysam.Fastafile( "ex1.fa" ) ++# try: ++# refs = [ x for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ) if x.reference_base == "*"] ++# except pysam.SamtoolsError: ++# pass ++ ++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile ) ++# calls = [ x for x in list(pysam.IteratorIndelCalls(i)) if x != None ] ++# for x,y in zip( refs, calls ): ++# self.checkEqual( x, y ) ++ ++# def testPerPositionViaCaller( self ): ++# # test pileup for each position. This is a fast operation ++# samfile = pysam.Samfile( "ex1.bam", "rb") ++# fastafile = pysam.Fastafile( "ex1.fa" ) ++# i = samfile.pileup( stepper = "samtools", fastafile = fastafile ) ++# caller = pysam.IndelCaller( i ) ++ ++# for x in pysam.pileup( "-c", "-f", "ex1.fa", "ex1.bam" ): ++# if x.reference_base != "*": continue ++# call = caller.call( x.chromosome, x.pos ) ++# self.checkEqual( x, call ) ++ ++class TestLogging( unittest.TestCase ): ++ '''test around bug issue 42, ++ ++ failed in versions < 0.4 ++ ''' ++ ++ def check( self, bamfile, log ): ++ ++ if log: ++ logger = logging.getLogger('franklin') ++ logger.setLevel(logging.INFO) ++ formatter = logging.Formatter('%(asctime)s %(levelname)s %(message)s') ++ log_hand = logging.FileHandler('log.txt') ++ log_hand.setFormatter(formatter) ++ logger.addHandler(log_hand) ++ ++ bam = pysam.Samfile(bamfile, 'rb') ++ cols = bam.pileup() ++ self.assertTrue( True ) ++ ++ def testFail1( self ): ++ self.check( "ex9_fail.bam", False ) ++ self.check( "ex9_fail.bam", True ) ++ ++ def testNoFail1( self ): ++ self.check( "ex9_nofail.bam", False ) ++ self.check( "ex9_nofail.bam", True ) ++ ++ def testNoFail2( self ): ++ self.check( "ex9_nofail.bam", True ) ++ self.check( "ex9_nofail.bam", True ) ++ ++# TODOS ++# 1. finish testing all properties within pileup objects ++# 2. check exceptions and bad input problems (missing files, optional fields that aren't present, etc...) ++# 3. check: presence of sequence ++ ++class TestSamfileUtilityFunctions( unittest.TestCase ): ++ ++ def testCount( self ): ++ ++ samfile = pysam.Samfile( "ex1.bam", "rb" ) ++ ++ for contig in ("chr1", "chr2" ): ++ for start in range( 0, 2000, 100 ): ++ end = start + 1 ++ self.assertEqual( len( list( samfile.fetch( contig, start, end ) ) ), ++ samfile.count( contig, start, end ) ) ++ ++ # test empty intervals ++ self.assertEqual( len( list( samfile.fetch( contig, start, start ) ) ), ++ samfile.count( contig, start, start ) ) ++ ++ # test half empty intervals ++ self.assertEqual( len( list( samfile.fetch( contig, start ) ) ), ++ samfile.count( contig, start ) ) ++ ++ def testMate( self ): ++ '''test mate access.''' ++ ++ with open( "ex1.sam", "rb" ) as inf: ++ readnames = [ x.split(b"\t")[0] for x in inf.readlines() ] ++ if sys.version_info[0] >= 3: ++ readnames = [ name.decode('ascii') for name in readnames ] ++ ++ counts = collections.defaultdict( int ) ++ for x in readnames: counts[x] += 1 ++ ++ samfile = pysam.Samfile( "ex1.bam", "rb" ) ++ for read in samfile.fetch(): ++ if not read.is_paired: ++ self.assertRaises( ValueError, samfile.mate, read ) ++ elif read.mate_is_unmapped: ++ self.assertRaises( ValueError, samfile.mate, read ) ++ else: ++ if counts[read.qname] == 1: ++ self.assertRaises( ValueError, samfile.mate, read ) ++ else: ++ mate = samfile.mate( read ) ++ self.assertEqual( read.qname, mate.qname ) ++ self.assertEqual( read.is_read1, mate.is_read2 ) ++ self.assertEqual( read.is_read2, mate.is_read1 ) ++ self.assertEqual( read.pos, mate.mpos ) ++ self.assertEqual( read.mpos, mate.pos ) ++ ++ def testIndexStats( self ): ++ '''test if total number of mapped/unmapped reads is correct.''' ++ ++ samfile = pysam.Samfile( "ex1.bam", "rb" ) ++ self.assertEqual( samfile.mapped, 3235 ) ++ self.assertEqual( samfile.unmapped, 35 ) ++ ++class TestSamtoolsProxy( unittest.TestCase ): ++ '''tests for sanity checking access to samtools functions.''' ++ ++ def testIndex( self ): ++ self.assertRaises( IOError, pysam.index, "missing_file" ) ++ ++ def testView( self ): ++ # note that view still echos "open: No such file or directory" ++ self.assertRaises( pysam.SamtoolsError, pysam.view, "missing_file" ) ++ ++ def testSort( self ): ++ self.assertRaises( pysam.SamtoolsError, pysam.sort, "missing_file" ) ++ ++class TestSamfileIndex( unittest.TestCase): ++ ++ def testIndex( self ): ++ samfile = pysam.Samfile( "ex1.bam", "rb" ) ++ index = pysam.IndexedReads( samfile ) ++ index.build() ++ ++ reads = collections.defaultdict( int ) ++ ++ for read in samfile: reads[read.qname] += 1 ++ ++ for qname, counts in reads.items(): ++ found = list(index.find( qname )) ++ self.assertEqual( len(found), counts ) ++ for x in found: self.assertEqual( x.qname, qname ) ++ ++ ++if __name__ == "__main__": ++ # build data files ++ print ("building data files") ++ subprocess.call( "make", shell=True) ++ print ("starting tests") ++ unittest.main() ++ print ("completed tests") diff --git a/debian/patches/series b/debian/patches/series new file mode 100644 index 0000000..ebb9930 --- /dev/null +++ b/debian/patches/series @@ -0,0 +1,3 @@ +fix_cleanup_tests.patch +do_not_use_distribute_setup.patch +offline-tests.patch diff --git a/debian/source/format b/debian/source/format new file mode 100644 index 0000000..163aaf8 --- /dev/null +++ b/debian/source/format @@ -0,0 +1 @@ +3.0 (quilt)